Study on the optimization of PCR detection conditions for pathogen isolated from the postharvest blueberry surface
-
Graphical Abstract
-
Abstract
The main pathogens were separated and identified from the rotting postharvest blueberry fruits using traditional pure culture method and plate streaking method.The results showed that the main pathogen was Botrytis cinerea.In order to identify Botrytis cinerea with PCR method and found its best experimental conditions,the Genomic DNA was extracted and the target gene was screened with specific primers. The optimum PCR experimental condition was as following : the primer sequences were Bc F- TGTAATTTCAATGTGCAGAATCC and BcR- TTGAAATGCGATTAATT GTTGC,the best amplification primer concentration was 0.25 μmol / L,the optimal annealing temperature was 60 ℃.This PCR method could effectively improve the detection efficiency of blueberry pathogens. Moreover,it helped to set up a theoretical basis and technical guidance for the preservation of blueberries in production.
-
-